Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-510-3p URS000075B179_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (ENA, GeneCards, IntAct, RefSeq, miRBase, MalaCards). Homo sapiens (human) hsa-miR-510-3p sequence is a product of miR-510-3p, hsa-miR-510-3p, miR-510, MIR510, hsa-miR-510 genes. Found in the human reference genome.

Interactions 4

According to IntAct, Homo sapiens (human) hsa-miR-510-3p interacts with:

Interaction id Participant Synonyms
EBI-22181014 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22181037 intact:EBI-20558519 EBI-20558519 ENST00000371953 mrna_pten
EBI-22180976 URS0000EEE2CE_9606 EBI-22180963 URS0000EEE2CE_9606 lncrna_linc00702
EBI-22181004 URS0000EEE2CE_9606 EBI-22180963 URS0000EEE2CE_9606 lncrna_linc00702

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUUGAAACCUCUAAGAGUGGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    Publications New