Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-647 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-647 precursor URS000075B0C4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-647: Hsa-mir-647 is a microRNA that is not associated with any specific diseases [PMC6995532]. In a study comparing bone marrow mesenchymal stem cells (BMSCs) from patients with steroid-induced osteonecrosis of the femoral head (SONFH) and patients with femoral neck fracture (FNF), hsa-mir-647 was found to be upregulated in the SONFH group [PMC5887684]. Another study found that hsa-mir-647 was downregulated in spinal cord samples from patients with amyotrophic lateral sclerosis (ALS) [PMC6834740]. Bioinformatical analysis revealed that hsa-mir-647 has potential binding sites in the circular RNA hsa_circ_0004018 [PMC5601662]. Hsa-mir-647 was also identified as one of the miRNAs in class 3, along with Hsa-miR-567 and Hsa-miR-328 [PMC4035288]. The miRNA target prediction tool miRTarBase identified 58 predicted target genes for hsa-mir-647 [PMC6995532]. In addition, hsa-mir-647 has been associated with transcriptional misregulation in cancer and the Hippo signaling pathway, along with other miRNAs such as hsa-miR-626 and hsa-miR-660-3p [PMC5601662]. In an experimental study, hsa-mir-647 mimics were used to co-transfect 293T cells along with a luciferase reporter vector [PMC5779906]. HsamiR_647 has also been identified as a potential target of circular RNA hsa_circ_0000257 [PMC6771114].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGAAGUGUUGGCCUGUGGCUGCACUCACUUCCUUCAGCCCCAGGAAGCCUUGGUCGGGGGCAGGAGGGAGGGUCAGGCAGGGCUGGGGGCCUGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications