Sus scrofa (pig) microRNA ssc-mir-145 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) microRNA ssc-mir-145 precursor URS000075AED0_9823

86 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 2 other species
422 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUGAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Catagonus wagneri (Chacoan peccary) microRNA 145 (ENSCWAG00000005689.1)
Erinaceus europaeus (western European hedgehog) microRNA 145 (ENSEEUG00000016053.1)

Publications