Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-142 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-142 precursor URS000075AE07_9606

  • 87 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 128 species

Automated summary: This pre miRNA sequence is 87 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, HGNC, Ensembl/GENCODE, miRBase, Ensembl, GeneCards, MalaCards, RefSeq). Described in 59 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-142, RF01896). Homo sapiens (human) microRNA hsa-mir-142 precursor sequence is a product of mir-142, hsa-mir-142 precursor, ENSG00000284353.1, mir-142 precursor, MIR142, mir-142 precurso genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 127 other species

    1. Ailuropoda melanoleuca microRNA 142 (ENSAMEG00000022130.2)
    2. Aotus nancymaae miRNA (ENSANAG00000011297.1)
    3. Artibeus jamaicensis (Jamaican fruit-eating bat) microRNA aja-mir-142 precursor
    4. Balaenoptera musculus (Blue whale) miRNA (ENSBMSG00010014869.1)
    5. Bos grunniens (domestic yak) microRNA 142 (ENSBGRG00000012558.1)
    6. Bos indicus x Bos taurus (hybrid cattle) microRNA 142 (ENSBIXG00000009569.1)
    7. Bos taurus (cattle) microRNA bta-mir-142 precursor
    8. Camelus dromedarius microRNA 142 (ENSCDRG00005022166.1)
    9. Canis lupus dingo (dingo) microRNA 142 (ENSCAFG00020025799.1)
    10. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020626.1, ENSCAFG00030008298.1, ENSCAFG00040000054.1)
    11. Capra hircus microRNA 142 (ENSCHIG00000001668.1)
    12. Carlito syrichta miRNA (ENSTSYG00000020736.2)
    13. Castor canadensis (American beaver) microRNA 142 (ENSCCNG00000023137.1)
    14. Catagonus wagneri microRNA 142 (ENSCWAG00000018463.1)
    15. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000020574.1)
    16. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000017115.1)
    17. Chlorocebus sabaeus miRNA (ENSCSAG00000021330.1)
    18. Colobus angolensis palliatus microRNA 142 (ENSCANG00000020450.1)
    19. Dasypus novemcinctus (nine-banded armadillo) microRNA 142 (ENSDNOG00000026448.1)
    20. Echinops telfairi miRNA (ENSETEG00000021490.1)
    21. Equus asinus asinus (donkey) miRNA (ENSEASG00005002791.1)
    22. Equus caballus miRNA (ENSECAG00000026328.2)
    23. Erinaceus europaeus microRNA 142 (ENSEEUG00000016026.1)
    24. Gorilla gorilla gorilla microRNA 142 (ENSGGOG00000032439.2)
    25. Loxodonta africana (African savanna elephant) microRNA 142 (ENSLAFG00000027413.1)
    26. Lynx canadensis microRNA 142 (ENSLCNG00005018269.1)
    27. Macaca fascicularis (Crab-eating macaque) miRNA
    28. Macaca mulatta microRNA mml-mir-142 precursor
    29. Macaca nemestrina miRNA (ENSMNEG00000006248.1)
    30. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000013133.1)
    31. Marmota marmota marmota (Alpine marmot) microRNA 142 (ENSMMMG00000020498.1)
    32. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000025514.1)
    33. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000018193.3)
    34. Moschus moschiferus microRNA 142 (ENSMMSG00000014741.1)
    35. Mustela putorius furo (Domestic ferret) microRNA 142 (ENSMPUG00000020206.1)
    36. Myotis lucifugus microRNA 142 (ENSMLUG00000030399.1)
    37. Neovison vison microRNA 142 (ENSNVIG00000012975.1)
    38. Nomascus leucogenys miRNA (ENSNLEG00000021129.2)
    39. Ochotona princeps miRNA (ENSOPRG00000017740.1, ENSOPRG00000018512.1)
    40. Oryctolagus cuniculus microRNA 142 (ENSOCUG00000018728.2)
    41. Otolemur garnettii miRNA (ENSOGAG00000017459.1)
    42. Ovis aries (sheep) miRNA (ENSOARG00020019675.1)
    43. Pan paniscus miRNA (ENSPPAG00000011531.1)
    44. Panthera leo microRNA 142 (ENSPLOG00000012736.1)
    45. Panthera pardus microRNA 142 (ENSPPRG00000013572.1)
    46. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000003325.1)
    47. Pan troglodytes (chimpanzee) ptr-mir-142 (ENSPTRG00000027845.2)
    48. Papio anubis miRNA (ENSPANG00000026971.2)
    49. Physeter catodon microRNA 142 (ENSPCTG00005009782.1)
    50. Pongo abelii microRNA 142 (ENSPPYG00000021840.1)
    51. Pongo pygmaeus microRNA ppy-mir-142 precursor
    52. Procavia capensis miRNA (ENSPCAG00000019870.1)
    53. Prolemur simus (greater bamboo lemur) microRNA 142 (ENSPSMG00000004093.1)
    54. Propithecus coquereli miRNA (ENSPCOG00000001762.1)
    55. Pteropus vampyrus microRNA 142 (ENSPVAG00000025678.1)
    56. Rattus norvegicus microRNA rno-mir-142 precursor
    57. Rhinolophus ferrumequinum microRNA 142 (ENSRFEG00010014735.1)
    58. Rhinopithecus bieti miRNA (ENSRBIG00000005489.1)
    59. Rhinopithecus roxellana microRNA 142 (ENSRROG00000012402.1)
    60. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000012670.1)
    61. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005011297.1)
    62. Sorex araneus microRNA 142 (ENSSARG00000016670.1)
    63. Spermophilus dauricus miRNA (ENSSDAG00000020528.1, ENSSDAG00000020529.1)
    64. Suricata suricatta (meerkat) microRNA 142 (ENSSSUG00005019666.1)
    65. Urocitellus parryii (Arctic ground squirrel) microRNA 142 (ENSUPAG00010014022.1)
    66. Ursus thibetanus thibetanus microRNA 142 (ENSUTTG00000019019.1)
    67. Vulpes vulpes microRNA 142 (ENSVVUG00000012499.1)
    2D structure New