v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 378 (LINC00378) URS000075AD84_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00378: LINC00378 is a non-coding RNA that has been associated with different causes of death and is linked to different types of cancers [PMC9637317]. In a study of African American individuals, a variant in LINC00378 (rs138347802) was found to be associated with DSM-5 diagnostic criterion counts, specifically when considering the interactive effect of childhood environmental risk factors [PMC8960411]. LINC00378 is mainly expressed in the testis and has Cyclin-Dependent Kinase Inhibitor 1A (CDKN1A) as its main target [PMC9637317]. Additionally, other variants in SAMD9, SLC5A12, FIBIN, and LINC00378 have been associated with different causes of death [PMC9637317]. SAMD9 is expressed broadly across many tissues but mainly in the esophagus (mucosa), transformed lymphocytes, and whole blood. SLC5A12 is mainly expressed in the kidney and small intestine. FIBIN is mainly expressed in arteries (aorta and tibial), tibial nerve, and vagina. LINC00378 expression is restricted to a few cell types including vascular, muscular, epithelial, and immune cells [PMC9637317]. Overall, LINC00378 plays a role in various biological processes and its variants have been linked to different health outcomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCCAAGUGUCUCCCCAAGUUAGCUCAAGGGCUUGGGAGAAACAAAGUGCUGUCCCUCAGCCUGGGCUGCUCAGAUCCUCAGUGGAAAGGAUCUACAGUGACUACAAUAACCAAGUGCUACAAAAACGCUGUGACGAGGAAUCUGAACAACAGAGAUUUGAGGGAAACAAAACACUUUCGACGAAGGUCCUGCUGCUUGUCUUCAGCUUGGUACCAAUUAGAGCUUCACUGGAGGUGAAAAGGGCAGACACGGUUGCUGAGUGGCUGGUUGGAGAGUCCCUGAGAGAUUACCCAAGAAACUCAGUUGCGGCACGUGGUGGAGCAGCCUCUCAGGAGAUUUUUAGGGAUGCAAGAUGAAAGGAGCUAAACAUAACUAUAGGAAAUGGAGGCUGUUAUCAGCAUCUAGCUUAGGAUGGCGAGCCAAGCAUGGCUCUCAGGUGCAACUCACAUGGAGACGUGGCUCUCAGGUAAAAGAUACAACUCAGUUUCAGAUAUUGCAAGAAAAGAAGCAAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications