Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Corvus moneduloides (New Caledonian crow) miRNA (ENSCMUG00000006485.1) URS000075AD70_1196302

  • 81 nucleotides
  • 1 database (Ensembl)
  • Found in 34 other species
  • pre_miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAACUAUUCAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Accipiter nisus (Eurasian sparrowhawk) microRNA 29b-1 (ENSANIG00000009901.1)
  2. Amazona collaria microRNA 29b-1 (ENSACOG00000008428.1)
  3. Apteryx rowi (Okarito brown kiwi) microRNA 29b-1 (ENSARWG00000001119.1)
  4. Aquila chrysaetos chrysaetos microRNA 29b-1 (ENSACCG00020003315.1)
  5. Athene cunicularia (burrowing owl) microRNA 29b-1 (ENSACUG00000003489.1)
  6. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000002644.1)
  7. Buteo japonicus (eastern buzzard) miRNA (ENSBJAG00000012279.1)
  8. Calidris pugnax microRNA 29b-1 (ENSCPUG00000000182.1)
  9. Calidris pygmaea microRNA 29b-1 (ENSCPGG00000016809.1)
  10. Camarhynchus parvulus (small tree finch) miRNA (ENSCPVG00000012994.2)
  11. Catharus ustulatus (Swainson's thrush) miRNA (ENSCUSG00005016816.1)
  12. Cyanistes caeruleus microRNA 29b-1 (ENSCCEG00000002577.1)
  13. Cyanoderma ruficeps microRNA 29b-1 (ENSCRFG00000001870.1)
  14. Dromaius novaehollandiae (emu) microRNA 29b-1 (ENSDNVG00000010767.1)
  15. Chloebia gouldiae miRNA (ENSEGOG00005005646.1)
  16. Falco tinnunculus miRNA (ENSFTIG00000008866.1)
  17. Ficedula albicollis (Collared flycatcher) microRNA 29b-1 (ENSFALG00000026388.1)
  18. Gallus gallus microRNA gga-mir-29b precursor (gga-mir-29b-1)
  19. Geospiza fortis (medium ground-finch) microRNA 29b-1 (ENSGFOG00000006703.1)
  20. Junco hyemalis (dark-eyed junco) microRNA 29b-1 (ENSJHYG00000017466.1)
  21. Lepidothrix coronata microRNA 29b-1 (ENSLCOG00000010284.1)
  22. Lonchura striata domestica (Bengalese finch) miRNA (ENSLSDG00000003489.1)
  23. Malurus cyaneus samueli miRNA (ENSMCSG00000004193.1)
  24. Manacus vitellinus (golden-collared manakin) miRNA (ENSMVIG00005019818.1)
  25. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000021044.1)
  26. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000014583.1)
  27. Parus major (Great Tit) microRNA 29b-1 (ENSPMJG00000000536.1)
  28. Serinus canaria (common canary) microRNA 29b-1 (ENSSCAG00000012530.1)
  29. Strigops habroptila microRNA 29b-1 (ENSSHBG00005002217.1)
  30. Strix occidentalis caurina miRNA (ENSSOCG00000000257.1)
  31. Struthio camelus australis (African ostrich) microRNA 29b-1 (ENSSCUG00000012131.1)
  32. Taeniopygia guttata (zebra finch) microRNA 29b-1 (ENSTGUG00000017869.2)
  33. Zonotrichia albicollis miRNA (ENSZALG00000001899.1)
  34. Zosterops lateralis melanops microRNA 29b-1 (ENSZLMG00000000676.1)