v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1484 (LINC01484) URS000075AC6C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01484: LINC01484 is a long intergenic non-protein coding RNA (lncRNA) that has been identified in various studies. It is one of the lncRNAs that overlapped with the CDE-lncRNAs and showed elevated expression levels in SK-MES-1 cells treated with CA [PMC7900626]. In renal cell carcinoma (RCC), LINC01484 was found to be overexpressed [PMC5675671]. It has also been identified as one of the lncRNAs that interacted with IPO5 [PMC10116350]. In the context of hypertension-related urinary albumin excretion (UAE), LINC01484 was found to be one of the topological hub nodes in a network analysis, suggesting its potential role in regulating key pathways associated with proteinuria and cardiovascular injury [PMC10017462]. Similarly, in a study on hypertension-related RNA network, LINC01484 was identified as a hub RNA that plays a significant role in network organization and may be a key regulator of UAE development [PMC8775608]. Furthermore, LINC01484 has been implicated as one of the lncRNAs with prognostic value in bladder cancer (BLCA) [PMC10102384]. Overall, these studies highlight the potential importance of LINC01484 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUAAACAAUAGGGCAGAGGAAGCAAUCGGAUAGGCAUUUGCUUCAGGUGAGCAGAGGGAUGACUUUCUGUCCCACAUCUGUGAAGAUCAGCUGUUGGUUUACAUUGCCAGGGUGAAAUUCAACAGAACUAAUUUAGGGUGAAGAUCUUGAGGCCCACAAGGAAUUUCCUUGUGGGAAAAUUGUGAGGAAGGAAUAGGUCCUUCUGUCACGGGGCACAGGACCCUUGACCGCAAAAUGACGUGAGUUACCACUGACUAUUUUCUGGGUCUUGAUCUUGUGACUCCAAAUGGAUGGUCUCCAGGACACAUGUGCAUGAGUUCCUCUAGGAAACCACGGUGUACAACUGCUGGGUUGCAGGCCCAGGGUUCUUUCCACUUCUCUAUCCUCCCAAGUAGGGUCCAGCUGGCCUUAGUGCUGCCAUGCUGAGAGCUCUGGGAGGGGCAACCCAGGGCAGACAGGCCCAGGCCAGCCACCCUGCCCCAGGCAUUUCCCAGGACUCAUCAGGCACCCAGCGGCCCCUCAGCAGUGAGCAAUACCAGAAAUCUGCCAGCUGGCUACUAACUGGGUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications