Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-637 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-637 precursor URS000075AC40_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-637: Hsa-mir-637 is a microRNA (miRNA) that has been reported to regulate relevant IRD-causative genes in response to oxidative stress injuries in retinal pigment epithelial (RPE) cells [PMC7222416]. It has been identified as one of the significantly differentially expressed miRNAs in RPE cells challenged with oxidizing compounds [PMC5865992]. Hsa-mir-637 mimics and inhibitors were used in a study to examine its molecular mechanism in regulating the malignant behaviors of hepatocellular carcinoma (HCC) [PMC7137343]. Bioinformatics analysis identified hsa-mir-637 as one of the potential target miRNAs for hsa_circ_0039053, a circular RNA involved in HCC [PMC7591988]. The binding position of hsa-mir-637 within a segment was found to be highly conserved among different influenza virus strains [PMC3521223]. Downregulation of hsa-mir-637 has also been observed in HCC samples, along with other miRNAs [PMC7444729]. Hsa-mir-637 has been associated with drug resistance, while other miRNAs like hsa-let-7d-5p and hsa-miR-18a-5p have been associated with drug sensitivity [PMC6504094]. It has also been identified as a potential regulator within a network of miRNAs that impact gene expression [PMC5569676]. Additionally, hsa-miR-328-3p, among other miRNAs, has been reported as diagnostic or prognostic biomarkers for glioma [PMC9983174]. The binding of hsa-mir-637 to the 3' untranslated region of ATP6V0A1 mRNA is disrupted by a polymorphism, leading to impaired secretion and function related to Chromogranin A (CHGA)/catestatin [PMC4554020]. Furthermore, hsa-mir-637 has been found to downregulate STAT3 activity in hepatocellular carcinoma cells [PMC6504094].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCUAAGGUGUUGGCUCGGGCUCCCCACUGCAGUUACCCUCCCCUCGGCGUUACUGAGCACUGGGGGCUUUCGGGCUCUGCGUCUGCACAGAUACUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications