v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2147 (LINC02147) URS000075AC32_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02147: LINC02147, a long non-coding RNA (lncRNA), has been shown to have excellent diagnostic and prognostic value for oral squamous cell carcinoma (OSCC) [PMC9338683]. A receiver operating characteristic (ROC) analysis and survival analysis conducted among 11 lncRNAs demonstrated the significance of LINC02147 in OSCC [PMC9338683]. In addition to LINC02147, the TNM stage and perineural invasion were also found to be independently related to the overall survival (OS) of OSCC patients [PMC9338683].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCUGCCAUGAUUGGAAGUUUCCUGAAGCCUCCCAGCCAUGCGGAACUUUCUGGAGGCUGGAAGUCCAAGAUCAAGGUGCUAUCAGGGUUGGUUUCGGCUGUGGCCUCUCUUCCUGGCUUGUAGACAGCUAUCUUCUCGCAGUGUCCUCACGUGGCCUCUUUGUGUGAAGCAACAGCUCCAUAUGUUGAUGUGAACUGUGACUCCAGGAGAACGGUGGAAAAGUGUCUUGAUCCAGGAAGGAAGGGGUAUAGAGAAAAUAUGAGUCUCACCACACUAGAAGCAACAUAUGCAAAAUCCAUCAAACACACCAUAAAAUCAAUGUGGGAGUAACAACACCUUGGCCUACUGCUCCCUGAAAAGUUUUUCUCUCGUCAAGUGAUGACAGGCGUACAUUUGUAAAUAAAUUACCAAGUUGCUUUUGAUUUGAUGGAGAAGGAAGAAAAGGAUUGUCUCCUGGAAGUAUUUUUAUUGUCUUAAUAGGUAGGAUAAUAUCUCUGUUCAGCAAACUGAGAUCUUUUGAGAAUCUUAACAAAUGUAUACCCCUCCCUCUCACCUUUUCCUCUCUGGUGUAUUUCAUAGGCAGCUUUGCUAACUGACUGCACUACUACAAAUAGAUUCUGUCACUUUAGAAAUAGGAUUUUUCCUUUUAUAGGCAGAUUGAUGGACUAAGUGUCAAGGUUUUAGAACAGUAGCAUGACUGGGGCAGACACUAUAAACCAUAAAUCCAGUAUUGACAAAUGUUCUAGCCAAUCCAGAUUUUCUAUUUGUUAAAUUGCCUUUAUGAAGUCAUACUUGUGCAGCACAGAAUAUGGAAAAUAAUUGACAAGUUCUGAGAAGCCAGUUACUGAGCUCAUAGUUUAAUAAAGAAAAUGUUAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications