Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1246 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1246 precursor URS000075AC0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1246: MIR1246 is a type of microRNA that has been studied in relation to tumor invasion, lymph node metastasis, distant metastasis, and cancer stage. However, serum and urine levels of MIR1246 did not show any correlations with these factors (Table 2) [PMC7250935]. Despite this, MIR1246 has been found to have a specific target called early B cytokine 1 (EBF1) [PMC8258133]. It binds to the 3′UTR site of EBF1 and potentially regulates its expression. These findings suggest that MIR1246 may have a role in cancer progression through its interaction with EBF1. However, further research is needed to fully understand the functional significance of this interaction and its implications in cancer development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAUCCUUGAAUGGAUUUUUGGAGCAGGAGUGGACACCUGACCCAAAGGAAAUCAAUCCAUAGGCUAGCAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications