v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 534 (LINC00534) URS000075ABFF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00534: LINC00534 is a long non-coding RNA (lncRNA) that has been investigated for its effects on trophoblast cell proliferation, migration, and apoptosis [PMC9833967]. It is a differential lncRNA that has been identified in the placental tissue of patients with preeclampsia (PE) [PMC9833967].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUUUUCUGGCAGAUUACUUCUGUGAGCAACUGGGUCUCUCAGUUCUUUGGGAGCACCCUGGGAAACAGUGUGGCUAUGACUUGGAGCUGCUCACCAGUUCCAGUCAUUCUGUGGUUGAGAGCUGCUCCCUAUGGAUGUUAAUUCUUCUCUAUUUUAGAUUUUCCACAGGUGUGGGCCCCAUUAGCUCUGGCCACCUGAGAAAGCCCUCAGGCAAAGAGUCGCAGGUGAAAGCCAGCAGUUAGAGGUUCACAGAAAUGAGUGCAGAAGCAUCUUCAGUUGGAGAGCCAUUGCCUCUUGCUGUGAAAUAUUUGGGAAUCUUCAGAAACCAUGAAGAAUAACCUGCUAAAGCUGAGCUGGGACUCUGCCUGGAUAUAACUUAUGGCCUAUUCUAUAUGGAAAGUUGGUUUUCUCACAGUUCCACUCCCUUUCCAGAUAUCAGCAAAUGGCCCUCCUAGCCCAGAAGUCUCCAGAGAGGGUUUUAUUUUGUCAGUCAAGCUGGAAUGCAGUGGCGUGAACAUUGCUUACUGCAGCUUCAAUCUCCUGAGGUCAAACAAUCUUCUCACCUCAGCCUCGCAAGCAGCUAGGACUACAGGCAUGUGCCACCACGCCCCACUAAUUUUUUAAUUUUUCUUUUGUGGAGACGCAGUCUUGUUAUCUUGAACAGGCUGGUCUUGAACUCUUGGAGUCAAGCAAUCCUUCUGCCUCAGACUCUCAAAGUGCUGGGAUUACAGGCAUGAGCCACCACAUUCAGCCAGGAAAAGUUUUUGUACAUUUAAAAAAUUAUAGGAUAUUUGUGUAUAUAGCUUUGCUGGUUUGACUUCCUAGAAUAGCUCCCAGGAACACAAAGUACUUAAUUGAUUAGUAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications