Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-5694 URS000075AB57_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5694: Hsa-mir-5694 is a miRNA that has been identified as strongly binding the AF9 mRNA 3' UTR and being significantly upregulated in breast cancer [PMC7934584]. In a study examining miRNA correlations, hsa-mir-5694 was found to have a strong inhibitory effect on PBK expression in MESO [PMC8632063]. Additionally, hsa-mir-5694, along with hsa-miR-5582-5p, hsa-miR-6745, and hsa-miR-374a-3p, has the ability to bind to the spike coding region of the SARS-CoV-2 genome [PMC9773347]. In the context of T1D, hsa-mir-5694 was identified as one of several miRNAs involved in target gene regulation [PMC8028841]. Specifically, it was found to target IGF2R along with 139 other miRNAs [PMC8028841]. Furthermore, several other genes and miRNAs were identified as potential biomarkers associated with T1D development including PRKACA, DSP, FOXD1, EYA1, TFAP2A, and GAB2 [PMC8028841]. The specific number of miRNAs targeting each gene is listed in Table 6 of the study [PMC8028841].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGAUCAUGGGACUGUCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications