Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3142 precursor URS000075AADA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3142: Hsa-mir-3142 is a human miRNA that has been studied in various contexts [PMC9427240]. In a study using the starBase database, hsa-mir-3142 was mapped to obtain putative circRNAs [PMC9427240]. Another study found that hsa-mir-3142, along with hsa-miR-30c-5p, targeted the RRM2 gene and showed differential expression in RIF [PMC9427240]. Additionally, DIANA was used to predict downstream miRNAs of TFAP2A-AS1, and hsa-mir-3142 was one of the 11 miRNAs identified [PMC8565027]. The relative expression levels of hsa-mir-3142 were evaluated using qRT-PCR in a study that also examined the expression levels of various other RNAs [PMC8565027]. In microarray analyses of different cell lines, hsa-mir-3142 was found to be differentially expressed in HRT-18 and Caco-2 cells [PMC5187811]. Specifically, in Caco-2 cells, hsa-mir-3142 showed differential expression after 12 and 24 hours [PMC5187811].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAGAAAGGCCUUUCUGAACCUUCAGAAAGGCUGCUGAAUCUUCAGAAAGGCCUUUCUGAACCUUCAGAAAGGCUGCUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications