Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-132 precursor URS000075A9DE_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-132: Rno-mir-132 is a microRNA that has been found to target matrix metalloproteinases (MMP) 9 and SPRY1, suggesting its involvement in cardiac fibrosis and hypertension [PMC5413218]. Treatment with angiotensin II (Ang II) for 24 hours has been shown to induce cardiac fibrosis and hypertension, with rno-mir-132 playing a role in this process [PMC5413218]. Rno-mir-132 is one of the differentially expressed miRNAs in the AKI model group compared to the control group, and its expression is reversed following MSC treatment [PMC6625446]. Rno-mir-132 is also one of the common miRNAs that are upregulated in the AKI group and downregulated in the MSC treatment group [PMC6625446]. In healthy Wistar islets, rno-mir-132 responds to glucose stimulation at different concentrations [PMC3072418]. The expression of rno-mir-132 shows fluctuations over time, with downregulation at certain time points followed by a return to baseline or further reduction [PMC5979605]. Rno-mir-132 has also been found to be downregulated in DHT-treated rats, suggesting its association with promoted thecal hyperandrogenesis [PMC3682887]. Hyperglycemia can upregulate the expression of rno-mir-132, but prolonged exposure may lead to a resetting of its levels back to control levels [PMC4620849]. The full sequence of zlg-mir-132 shows similarities with other species' miR-132 sequences such as hsa-miR-132 and tgu-miR-132 [PMC4636775]. In PC12 cells, modulation of rno-miR-132 expression can be achieved through antisense or mimics transfection methods for further study purposes [PMC3420912].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACCGGAGGUAACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications