Automated summary: This pre miRNA sequence is 74 nucleotides long and is found in Mus musculus. Annotated by 5 databases (miRBase, MGI, ENA, Ensembl, RefSeq). Described in 13 papers. Matches 1 Rfam family (mir-465, RF03464). Mus musculus (house mouse) microRNA mmu-mir-465a precursor sequence is a product of mir-465a precurso, mir-465a, mir-465a precursor, Mir465, mmu-mir-465a precursor, ENSMUSG00000070071.3 genes. Found in the mouse reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GCCCUAUUUAGAAUGGCACUGAUGUGAUAAAAUAAAAAAUUGAUCAGGGCCUUUCUAAGUAGAGUAAGGCUUAC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.