Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-200a precursor URS000075A884_9606

  • 90 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, IntAct, MalaCards, miRBase, RefSeq)
  • Found in 4 species

Automated summary: This pre miRNA sequence is 90 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (Ensembl, HGNC, IntAct, miRBase, Ensembl/GENCODE, GeneCards, RefSeq, MalaCards, ENA). Described in 55 papers. Matches 1 Rfam family (mir-8, RF00241). Homo sapiens (human) microRNA hsa-mir-200a precursor sequence is a product of mir-200a, MIR200A, mir-200a precurso, mir-200a precursor, hsa-mir-200a precursor, ENSG00000207607.3 genes. Found in the human reference genome.

Interactions 4

According to IntAct, Homo sapiens (human) microRNA hsa-mir-200a precursor interacts with:

Interaction id Participant Synonyms
EBI-11170142 reactome:R-HSA-6789244 3.1.26.3 AGO2:DICER1:TARBP2 EBI-10816154 R-HSA-6789244 RISC-loading complex, TARBP2 variant RLC complex SIGNOR-C32 miRLC complex microRNA loading complex tarbp2-risc_complex_human
EBI-11169618 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human
EBI-11169760 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human
EBI-11169807 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 3 other species