Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-499b precursor URS000075A7FA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR499B: MIR499B is a non-coding RNA gene that is transcribed from the reverse strand of the same genomic region as MIR499A [PMC5591547]. Multiple sequence alignment and phylogenetic tree construction were used to identify similarity regions in different species, including MIR499B [PMC5591547]. Variant analysis of MIR499A revealed the presence of 30 non-coding transcript exon variants, including 19 overlapping variants in MIR499B [PMC5591547]. Computational tools predicted that miR-499a and MIR499B target key molecules in asthma-related KEGG pathways [PMC5591547]. Bioinformatics analysis showed a common polymorphism within the seed region of mature miR-499a-3p in both MIR499A and MIR499B genes [PMC5591547]. The MIR499A gene is located within intron 19 of the MYH7B gene, while MIR499B forms a shorter transcript from the reverse strand [PMC5591547]. Hsa-miR-499b is another miRNA precursor encoded from the opposite strand of the same region as MIR499A and processed into hsa-miR-499b-5p and hsa-miR-499b-3p [PMC6359604]. The rs3746444:T>C polymorphism in both mature MIR499A and seed of MIR499B was found to be inversely associated with cardia localization of adenocarcinoma [PMC6687864]. This polymorphism may influence processing and expression of both genes, potentially affecting their target genes in a dosage-dependent manner [PMC6687864]. Associations were found between different gastric adenocarcinoma subtypes and several single nucleotide variants (SNVs), including rs3746444:T>C in the seed of MIR499A and mature MIR499B [PMC6687864].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAAGCAGCACAGACUUGCUGUGAUGUUCACGUGGAGAGGAGUUAAACAUCACUGCAAGUCUUAACAGCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Publications