Bos taurus (cattle) microRNA bta-mir-1468 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-1468 precursor URS000075A7B0_9913

97 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 4 other species
81 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUUGAAGAGGUGGGUGGUUUCUCCGUUUGCCUGUUUUGCUGAUGUUCAUUUGACUUAUUCUCAGCAAAAUAAGCAAAUGGAAAAUUCAUCCAUCAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Bison bison bison miRNA (ENSBBBG00000006538.1)
Bos grunniens miRNA (ENSBGRG00000010095.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00005015282.1)
Bos mutus (wild yak) miRNA (ENSBMUG00000012343.1)

Publications