Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6728-5p URS000075A56F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6728: Hsa-mir-6728 is a miRNA gene that has been identified as a candidate driver gene in various types of cancer, including Pan-Cancer, UCEC, KIRP, LIHC, LUSC, PAAD, OV, LUAD, KIRC, GBM, DLBC, COAD and CESC [PMC7648123]. In the context of HCC (hepatocellular carcinoma), the potential target genes of hsa-mir-6728 are ENTPD5 and NT5C3A [PMC7794682]. Hsa-mir-6728 is also associated with low expression in tumor tissue in HCC patients [PMC5912208]. However, the specific mechanisms and pathways involving hsa-mir-6728 in HCC have not been determined [PMC7150540]. Overall, hsa-mir-6728 is a miRNA gene that has been implicated as a candidate driver gene in various types of cancer. In HCC specifically, it has been associated with potential target genes ENTPD5 and NT5C3A. Additionally it has been found to have low expression in tumor tissue. However further research is needed to fully understand the mechanisms and pathways involving hsa-mir-6728 in HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGGGAUGGUAGGACCAGAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications