Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus asinus asinus (donkey) microRNA 2052 (ENSEASG00005020224.1) URS000075A536_83772

  • 55 nucleotides
  • 1 database (Ensembl)
  • Found in 27 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUUUUGAUAACAGUAAUGUCCCUUUAGUUCAAAGUUACCAGCUAUCAAAACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Bison bison bison miRNA (ENSBBBG00000023846.1)
  2. Bos grunniens microRNA 2052 (ENSBGRG00000015887.1)
  3. Bos mutus (wild yak) miRNA (ENSBMUG00000019355.1)
  4. Camelus dromedarius (Arabian camel) microRNA 2052 (ENSCDRG00005013020.1)
  5. Canis lupus dingo microRNA 2052 (ENSCAFG00020017837.1)
  6. Canis lupus familiaris miRNA (ENSCAFG00000041660.2, ENSCAFG00030013298.1, ENSCAFG00040018016.1, ENSCAFG00845029187.1)
  7. Capra hircus miRNA (ENSCHIG00010005781.1)
  8. Cervus hanglu yarkandensis microRNA 2052 (ENSCHYG00000010180.1)
  9. Equus asinus (ass) microRNA 2052 (ENSEASG00005020224.2)
  10. Equus caballus (horse) microRNA 2052 (ENSECAG00000028449.1)
  11. Felis catus (domestic cat) microRNA 2052 (ENSFCAG00000046875.1)
  12. Homo sapiens microRNA hsa-mir-2052 precursor
  13. Macaca fascicularis microRNA 2052 (ENSMFAG00000060051.1)
  14. Macaca mulatta microRNA 2052 (ENSMMUG00000054374.1)
  15. Marmota marmota marmota microRNA 2052 (ENSMMMG00000005368.1)
  16. Neogale vison microRNA 2052 (ENSNVIG00000015202.1)
  17. Oryctolagus cuniculus (rabbit) microRNA 2052 (ENSOCUG00000032559.1)
  18. Ovis aries (sheep) microRNA 2052 (ENSOARG00020014723.2)
  19. Panthera leo (lion) microRNA 2052 (ENSPLOG00000004791.1)
  20. Pan troglodytes miRNA
  21. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA (ENSPTEG00000014185.1)
  22. Pongo abelii microRNA 2052 (ENSPPYG00000034906.1)
  23. Sciurus vulgaris (Eurasian red squirrel) microRNA 2052 (ENSSVLG00005002339.1)
  24. Spermophilus dauricus miRNA (ENSSDAG00000014144.1)
  25. Theropithecus gelada (gelada) microRNA 2052 (ENSTGEG00000023519.1)
  26. Urocitellus parryii microRNA 2052 (ENSUPAG00010011518.1)
  27. Vulpes vulpes microRNA 2052 (ENSVVUG00000019512.1)