Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4534 precursor URS000075A377_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4534: Hsa-mir-4534 is identified as an upstream regulatory miRNA and is associated with worse survival in breast cancer [PMC9906202]. It is suggested that hsa-mir-4534 may be a potential upstream miRNA of ADAMDEC1 [PMC9906202]. The correlation between hsa-mir-4534 and immune cells was investigated, and it was found that hsa-mir-4534 exhibits differential expression in normal and malignant human β cells, although its function is not clear [PMC9906202]. Hsa-mir-4534 was found to be associated with poor overall survival in breast cancer patients [PMC9906202]. There is a negative correlation between ADAMDEC1 and hsa-mir-4534, as well as a negative correlation between hsa-mir-4534 and most immune cell gene markers [PMC9906202]. The lncRNA TUG1 was found to be positively linked to ADAMDEC1 and negatively associated with hsa-mir-4534, suggesting it may be the most likely upstream lncRNA of ADAMDEC1 and hsa-mir-4534 [PMC9906202]. Hsa-miR-22-3p, hsa-miR-3202, hsa-miR-32-3p, and hsa-mir-4534 were identified as miRNAs that regulate the greatest number of genes [PMC7543140]. HSA-MIR 32 3p was downregulated in osteoporotic samples compared to osteoarthritic samples, while other miRNAs including HSA-MIR 22 3p were upregulated in osteoporotic samples compared to osteoarthritic samples [PMC7543140]. HSA-MIR 32 3p was also identified as one of the central genes in the PPI network along with HSA-MIR 4534 [PMC9532506]. TaqMan probes for hsa-mir-4534 were used in experimental studies [PMC5356562].

MIR4534: MIR4534 is a miRNA that has limited studies in pancreatic cancer [PMC10057657]. It has been identified as a differentially expressed miRNA in the transition from normal to tumor and tumor to F1 models [PMC10057657]. One study suggested that MIR4534 may play a role in prostate cancer through the regulation of PTEN [PMC10057657]. In CCD-18Co cells transfected with MIR4534 mimic, the relative expression levels of ACTA2 and CXCL12 mRNA were higher compared to cells transfected with miR control [PMC8484348]. Additionally, the autophagy of CCD-18Co cells transfected with MIR4534 mimic was more suppressed compared to cells transfected with miR control [PMC8484348]. Further investigation is warranted for MIR4534 and its potential role in pancreatic cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGAAUGACCCCCUUCCAGAGCCAAAAUCACCAGGGAUGGAGGAGGGGUCUUGGGUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications