Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MRPS9 antisense RNA 1 (MRPS9-AS1) URS000075A2BB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MRPS9-AS1: MRPS9-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to prognosis in various types of cancer, including colon cancer and pRCC (papillary renal cell carcinoma) [PMC9863050]. In a study, five lncRNAs, including MRPS9-AS1, were identified as poor prognostic predictors in colon cancer patients [PMC9863050]. The expression of MRPS9-AS1 was found to be elevated in high-risk patients with colon cancer, indicating its association with a poor prognosis [PMC9863050]. Furthermore, a prognostic model was constructed using five lncRNAs, including MRPS9-AS1, which showed high accuracy in predicting overall survival [PMC9863050]. In another study on pRCC patients, MRPS9-AS1 was identified as one of the five prognostic-associated lipid metabolism-related lncRNAs [PMC9590147]. The expression levels of MRPS9-AS1 and the other four lncRNAs were found to be associated with molecular subtypes [PMC9590147]. A risk score equation was developed using the expression levels of these five lncRNAs to better predict patient prognosis [PMC9590147]. This research on the relationship between MRPS9-AS1 and tumor prognosis is considered the first of its kind [PMC9590147]. The findings suggest that MRPS9-AS1 has potential as a prognostic biomarker and can guide personalized immunotherapy and medication for pRCC patients based on individual differences [PMC9863050][PMC9590147].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUUCCUUCUAGCAACUCCCUGCUCCUGCAGUCCCUCCGUGACCUUCCUGAUGGGGAGAUCCUCAAGACUUUUCCCAUGAGCUCGGGGUUCCUGAGGCCCAGAAGAAGAGGACAGAGUUUUAAUGGAGACAAGAGGCAGAGAAGAAAAACUUACUGUAAAGUGCGAAGAUGGUCUUCAGCUCAAACUUCCCCAAUUUAUUCCAACUUCUAAAGCAGUAGUCUAAGGCACUAGGACAAGAAGCAGAUGAACAUGUAUAGCCAGUAUUGGGCCACCAUGCCCGUCCCACCUAGACUCAUACCUUGUCUCAUCCACUCGACCUCGUCCUCGGUGACAAAGCUGCACAAGGCUUUUGCCAUUGCCAGUCGUAUUGCUCCAGCCUGCGCUGACCUCCCGCCCCCUGAGACUGUGCAGGUCACGUCGUGCUUUCCCAGCCGGUCAACAAAGUGGAAAGGGAACAUCAGCUGUUCUCUAAAGCACAGCACAAGUAAAUGUGGUUACGUUUACUAUAAAGAUACAUAAUUAUGUAAACAACUGAAAUUCUGAAUAUUCAUAAAAACAAUAUUCUGCAUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications