v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) HOXA cluster antisense RNA 2 (HOXA-AS2) URS000075A2B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

HOXA-AS2: HOXA-AS2 is a long non-coding RNA (lncRNA) transcribed from the HOXA cluster and located between and antisense to the human HOXA3 and HOXA4 genes [PMC6726592]. It has been implicated in various diseases, including endometrial carcinoma [PMC7393821], glioblastoma [PMC7798264], chronic obstructive pulmonary disease (COPD) [PMC9234692], gallbladder cancer [PMC9592229], gastric cancer [PMC5503528], hepatocellular carcinoma (HCC) [PMC7602917], acute myeloid leukemia (AML) [PMC7710717], breast cancer, osteosarcoma, papillary thyroid cancer, and glioma [PMC7509505]. HOXA-AS2 is involved in cell proliferation, migration, invasion, apoptosis, cell cycle regulation, and drug resistance in various cancers [PMC7393821] [PMC7798264] [PMC9234692] [PMC9592229] [PMC5503528] [PMC7602917] [PMC7710717] [PMC7509505]. It interacts with molecules such as miRNAs (e.g., miR-520c-3p/miR-520c/miR-567/miR-509-3p), enhancers of EZH2 and LSD1, and regulatory factors related to cell cycle and metastasis [PMC8436538]. HOXA-AS2 expression is upregulated in several cancers, including colorectal cancer cells with resistance to Adriamycin treatment, and is associated with advanced tumor stage, lymph node metastasis, larger tumor size, distant metastasis, and poor prognosis [PMC6726592] [PMC9592229] [PMC9686854]. The expression of HOXA-AS2 can be regulated by factors such as microglial polarization state [PMC8436538]. These findings suggest that HOXA-AS2 may serve as a potential diagnostic biomarker and therapeutic target for several diseases [PMC6726592].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAAAGGAAACGCCAAGACAUAGAAAACCACGCUUUUCCCGUAGGAAGAACCGAUGAUGAGCCCUGAUGAAAGAAGGAAGAAGACCCGCUGUCUGCGAAGGCCUAAAGGCCGCGGUUGCCAGGAACCGUGGAGGGCCAACUCCUCCCAACCGCCCUGGUGCAAAGUCCCACGCGGCGAAGAGUUUUGGAGCAGCGCUUACCUAGAAAGAUGUUUAAAUUCUGAACCAGGAAUUGUCUCCAACUCCAGGCGCUCAGGGAAUCGCCUUUUCCGGUGUCCAGGCGCUCUGCAGACAAAUAAACAGCAGAAGCAAAUGGUCACCGAGCCGGCAGUCAGCUUUCUGGGAGUGGGAGAUGAUGGGGAAAGAGGAAAGAAUCGUCCGCUCGCCGGACCCUGGCUUGGAGAAGUUCUGCGCUCCGCUGGGACUCUGCGGGCCCUUUGCGUCUACAGACCUAUCCCUGCCCCGACUACCCCUUCACUCAGACCCAGGGAAGGACACGUUUCUAUGCCUUACAGAGACUUGAAGCCUGAAAGCCUGGCCAAGUUUGGGAAGAAGAGGAGCCCUCUCAGAGCUCAAGAGCCUUCCUACUCUUUGGAACUUUUCCACAGUAGGCCAAGCUUGACAAGAGUUCAGCUCAAGUUGAACAUACAUACACACACUCUCACACACAAAUUAUGUGAGCCGUCAGAAUCCAAGUGAAUCCAGCUCAAGCUAUCUACAAGGUUUUUACAUGCAAGGUCAAGUAUCUCAAUCCAGAGGACUUUUGUUUUCUUAAUGAAAAGCUUAGAAAACACAUGAAUCUUAGAUUUUUAAUGUUUUUUAAAUGGAGUUUAUUCUUAGCACAUGGCUUUCUAUGUAGCCACAUCACAAUUUGUACAGUUCCACAUAAGUCUAAAUGCACUCCCCUCUCCCCAAAGACCGUGCCCCAGAAGGGGACAACAGUAUCUCUGUAACAGUGUCUUAAAUAAAUGCAAGUAAGAAAAACUAACAUGUCACACCUACCAUCAAGGUCUACACAUCUUAAGAAUUAAAUAAUCUUGUGAGGUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications