Eptesicus fuscus (big brown bat) efu-miR-135 URS000075A230_29078

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 7 other species
• 41 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGUAGGGAUGGAAGCCAUGAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

1. Canis lupus familiaris cfa-miR-135a-3p
2. Chrysemys picta cpi-miR-135-2-3p
3. Mus musculus Mus_musculus piRNA piR-mmu-8298855
4. Pteropus alecto (black flying fox) pal-miR-135-3p
5. Python bivittatus pbv-miR-135-2-3p
6. Rattus norvegicus (Norway rat) rno-miR-135a-3p
7. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-5215516

Publications Download

• FASTA
• JSON