Pan paniscus (bonobo) microRNA 3677 (ENSPPAG00000000513.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 3677 (ENSPPAG00000000513.1) URS000075A213_9597

60 nucleotides
1 database (Ensembl)
Found in 4 other species
5 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCAGUGGCCAGAGCCCUGCAGUGCUGGGCAUGGGCUUCUCGUGGGCUCUGGCCACGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Gorilla gorilla gorilla miRNA (ENSGGOG00000038312.1, ENSGGOG00000044211.1)
Homo sapiens microRNA hsa-mir-3677 precursor
Pan troglodytes microRNA 3677 (ENSPTRG00000039497.2)
Pongo abelii microRNA 3677 (ENSPPYG00000038082.1)

Publications