Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-582 URS000075A1F0_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-582: Cfa-mir-582 is a microRNA that has been studied in the context of canine myxomatous mitral valve disease (MMVD). In several studies, the expression of cfa-mir-582 has been found to be downregulated in dogs with MMVD, specifically in stages B1/B2 or C/D, compared to normal dogs [PMC5533140] [PMC9607079] [PMC4964495]. Additionally, cfa-mir-582 expression was found to be higher in dogs with more advanced stages of MMVD (C/D) compared to earlier stages (B1/B2) [PMC9607079]. In dogs with MMVD and mild to moderate cardiac enlargement or congestive heart failure, cfa-mir-582 was one of the seven downregulated miRNAs compared to normal dogs [PMC4964495]. Furthermore, cfa-mir-582 expression was significantly different between stages B1/B2 and C/D [PMC4490541]. Overall, these studies suggest that cfa-mir-582 may play a role in the progression and severity of MMVD in dogs. However, further research is needed to fully understand its specific functions and mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACAGUUGUUCAACCAGUUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Publications