Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-381 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-381 precursor URS000075A1A8_9606

  • 75 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 24 species

Automated summary: This pre miRNA sequence is 75 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, Ensembl, GeneCards, miRBase, Ensembl/GENCODE, ENA, MalaCards, HGNC). Described in 43 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-381 precursor sequence is a product of hsa-mir-381 precursor, MIR381, mir-381 precurso, mir-381, mir-381 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCAAGCUCUCUGUGAGUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Aotus nancymaae miRNA
    2. Carlito syrichta (Philippine tarsier) miRNA
    3. Cercocebus atys (Sooty mangabey) miRNA
    4. Colobus angolensis palliatus microRNA 381
    5. Cricetulus griseus (Chinese hamster) microRNA 381
    6. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 381
    7. Macaca fascicularis (Crab-eating macaque) miRNA
    8. Macaca mulatta microRNA mml-mir-381 precursor
    9. Macaca nemestrina miRNA
    10. Mandrillus leucophaeus (Drill) miRNA
    11. Mesocricetus auratus (Golden Hamster) microRNA 381 (Mir381)
    12. Microtus ochrogaster microRNA 381
    13. Mus caroli microRNA 381
    14. Mus musculus (house mouse) microRNA mmu-mir-381 precursor
    15. Mus pahari microRNA 381
    16. Mus spretus microRNA 381
    17. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    18. Pan paniscus (bonobo) miRNA
    19. Pan troglodytes (chimpanzee) ptr-mir-381
    20. Papio anubis (Olive baboon) miRNA
    21. Pongo abelii microRNA 381
    22. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-381 precursor
    23. Rhinopithecus bieti miRNA
    24. Rhinopithecus roxellana miRNA
    25. Saimiri boliviensis boliviensis miRNA
    2D structure New