Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-599 URS000075A123_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-599: Cfa-mir-599 is a type of microRNA that has been found to exhibit changes in expression levels in relation to disease progression, development of heart failure, and age in dogs [PMC8400600]. It has been associated with naturally occurring myxomatous mitral valve disease (MMVD) in dogs, which closely resembles mitral valve prolapse (MVP) in humans [PMC7696149]. Studies have shown that cfa-mir-599 expression is increased in older normal dogs compared to young normal dogs and dogs with MMVD [PMC5533140]. However, there is a downregulation of cfa-mir-599 in dogs with MMVD compared to normal older dogs [PMC5533140]. Other microRNAs, such as cfa-miR-9, cfa-miR-181c, and cfa-miR-495, have also been found to exhibit changes in expression levels that correlate with disease progression and age [PMC8400600] [PMC7696149] [PMC5533140]. These findings suggest that cfa-mir-599 and other microRNAs may play a role in the development and progression of heart disease in dogs. Further research is needed to fully understand the mechanisms underlying these changes and their potential as diagnostic or therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUGUGUCAGUUUAUCAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Bos taurus bta-miR-599
  2. Homo sapiens hsa-miR-599
  3. Macaca mulatta mml-miR-599-3p
  4. Monodelphis domestica mdo-miR-599-3p
  5. Pan troglodytes ptr-miR-599
  6. Pongo pygmaeus (Bornean orangutan) ppy-miR-599
Publications