v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000009425.1) URS000075A0E6_336983

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUGUCCUUUUUCGGUUAUCAUGGUACCGAUGCUGUAUAUCUGAAAGGUACAGUACUGUGAUAACUGAAGAAUGGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000000398.1)
  2. Bos taurus microRNA bta-mir-101 precursor (bta-mir-101-2)
  3. Capra hircus microRNA 101-2 (ENSCHIG00000002565.1)
  4. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000019582.2)
  5. Cebus imitator (Panamanian white-faced capuchin) microRNA 101-2 (ENSCCAG00000018415.1)
  6. Cercocebus atys miRNA (ENSCATG00000012982.1)
  7. Gorilla gorilla gorilla microRNA 101-2 (ENSGGOG00000031605.2)
  8. Homo sapiens microRNA hsa-mir-101 precursor (hsa-mir-101-2)
  9. Macaca mulatta microRNA mml-mir-101 precursor (mml-mir-101-2)
  10. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000033039.1)
  11. Microcebus murinus (gray mouse lemur) microRNA 101-2 (ENSMICG00000018948.3)
  12. Pan paniscus (bonobo) microRNA 101-2 (ENSPPAG00000005721.1)
  13. Pan troglodytes ptr-mir-101-2 (ENSPTRG00000027783.3)
  14. Pongo abelii miRNA
  15. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-101 precursor (ppy-mir-101-2)
  16. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000002958.1)
  17. Rhinopithecus bieti miRNA (ENSRBIG00000006692.1)
  18. Rhinopithecus roxellana miRNA (ENSRROG00000020455.1)
  19. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000014244.1)