Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-330 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-330 precursor URS000075A0E5_9606

  • 94 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 16 species

Automated summary: This pre miRNA sequence is 94 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl, ENA, Ensembl/GENCODE, GeneCards, RefSeq, HGNC, MalaCards, miRBase). Described in 41 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-330, RF00770). Homo sapiens (human) microRNA hsa-mir-330 precursor sequence is a product of mir-330 precursor, mir-330 precurso, hsa-mir-330 precursor, mir-330, MIR330 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUUUGGCGAUCACUGCCUCUCUGGGCCUGUGUCUUAGGCUCUGCAAGAUCAACCGAGCAAAGCACACGGCCUGCAGAGAGGCAGCGCUCUGCCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Aotus nancymaae miRNA
    2. Cercocebus atys (Sooty mangabey) miRNA
    3. Chlorocebus sabaeus (African green monkey) miRNA
    4. Colobus angolensis palliatus microRNA 330
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 330
    6. Macaca fascicularis (Crab-eating macaque) miRNA
    7. Macaca mulatta microRNA mml-mir-330 precursor
    8. Macaca nemestrina miRNA
    9. Mandrillus leucophaeus (Drill) miRNA
    10. Pan paniscus (bonobo) miRNA
    11. Pan troglodytes (chimpanzee) ptr-mir-330
    12. Papio anubis (Olive baboon) miRNA
    13. Pongo abelii microRNA 330
    14. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-330 precursor
    15. Rhinopithecus bieti miRNA
    16. Rhinopithecus roxellana microRNA 330
    17. Saimiri boliviensis boliviensis miRNA
    2D structure New