Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) microRNA rno-mir-628 precursor secondary structure diagram

Rattus norvegicus (Norway rat) microRNA rno-mir-628 precursor URS000075A037_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-628: Rno-mir-628 is a microRNA that has been studied in various contexts. TaqMan mature miR assays were used to quantify the expression levels of rno-mir-628, along with other miRNAs, in a study [PMC5838212]. In another study, rno-mir-628 was predicted to have ceRNA relationships with rno_circRNA_0009301 [PMC8720857]. Furthermore, rno-mir-628 was found to be highly upregulated in a group of miRNAs that showed statistically significant changes [PMC4657244]. Comparing the expression changes in different groups, it was observed that rno-mir-628 showed similar expression changes in both groups at the same postoperative time point [PMC4198680]. However, the expression levels of rno-mir-628 were too low for qRT-PCR analysis in rat liver tissue [PMC4198680]. Overall, these studies provide insights into the expression and potential functions of rno-mir-628.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUGUUGUGUCGCUUCCUCAUGCUGACAUAUUUACGAGAGGGUGCAAUUCAUAACCUUCUGGUAAGAGUGGCAGUUGAGGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications