Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-378d precursor URS000075A018_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-378d: Seven miRNAs (mmu-miR-574-5p, mmu-miR-466i-5p, mmu-miR-342-3p, mmu-let7i-5p, mmu-miR-34a-5p, mmu-miR-188-5p, and mmu-miR-5119) were upregulated, while five miRNAs (mmu-miR-378a-3p, mmu-miR-202-3p, mmu-miR-378b, mmu-mir-378d, and mmu-miR-212-3p) were downregulated in the CCl4 group compared to the control group [PMC4804167]. Real-time quantitative reverse transcriptional polymerase chain reaction (qRT-PCR) was performed to validate the expression levels of these miRNAs in liver tissues [PMC4926493]. Among the identified miRNAs, mmu-mir-378d was found in both comparison groups and selected for further quantification [PMC5331689]. Mmu-mir-378d is part of a ceRNA network specific to palmitic acid and is predicted to target specific circRNAs and mRNAs involved in glucose metabolism [PMC8806959]. In the AS group, mmu-mir-378d showed a significant increase compared to the control group, suggesting its potential as a noninvasive biomarker for AS [PMC9403256].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUGCUGGGAUAGCACUGGCCUUGGAGUCAGAAGGUUUGUGAUUUGGUGGCAGCUCUGCCAUCCAAUAUCCCUGUGAUUUUUAGGGUGUCAGUUUCCCUUUAAGCACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications