Aotus nancymaae (Ma's night monkey) microRNA 302b (ENSANAG00000006802.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Aotus nancymaae (Ma's night monkey) microRNA 302b (ENSANAG00000006802.1) URS0000759FEB_37293

73 nucleotides
1 database (Ensembl)
Found in 6 other species
31 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCUCCCUUCAACUUUAACAUGGAAGUGCUUUCUGUGACUUUAAAAGUAAGUGCUUCCAUGUUUUAGUAGGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Gorilla gorilla gorilla microRNA 302b (ENSGGOG00000037056.1, ENSGGOG00000037124.1)
Homo sapiens microRNA hsa-mir-302b precursor
Pan paniscus (bonobo) microRNA 302b (ENSPPAG00000000701.1)
Pan troglodytes ptr-mir-302b (ENSPTRG00000027779.2)
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 302b (ENSSBOG00000001391.1)

Publications