Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1205 URS0000759FAE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1205: Hsa-mir-1205 is a candidate miRNA that has been identified in several studies and has been investigated for its role in various biological processes. It has been shown to be involved in suppressing or promoting the formation of osteosarcoma (OS) [PMC6948356]. Hsa-mir-1205 is a miRNA that can interact with hsa_circ0021347 and has been predicted to have interactions with 190 target mRNAs [PMC6948356]. It is also one of the target miRNAs for hsa_circRNA_0079201, along with other miRNAs such as hsa-miR-140-3P and hsa-miR-1225-3P [PMC7595675]. Hsa-mir-1205 has been found to regulate genes such as ABCA9 and MTA1, promoting proliferation, migration, and invasion of PTC cells [PMC7859334]. However, the expression of hsa-mir-1205 was found to be very low or undetectable in both normal and tumor prostate samples [PMC3140991]. Hsa-mir-1205 has also been predicted to bind with other circRNAs such as circ_0088300 [PMC8188357]. It is important to note that the expression level of hsa-mir-1205 can vary depending on the context, as it was found to be downregulated in PEXG but upregulated in other conditions [PMC10000531]. Overall, hsa-mir-1205 is a candidate miRNA that plays a role in various biological processes but its expression level can vary depending on the context.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGCAGGGUUUGCUUUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-1205
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-1205
Publications