Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-301a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-301a precursor URS0000759EFA_9606

  • 86 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 63 species

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl, HGNC, miRBase, Ensembl/GENCODE, GeneCards, RefSeq, MalaCards, ENA). Described in 48 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-301, RF02061). Homo sapiens (human) microRNA hsa-mir-301a precursor sequence is a product of MIR301A, mir-301a precursor, mir-301a precurso, hsa-mir-301a precursor, ENSG00000207996.1, mir-301a genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 62 other species

    1. Aotus nancymaae miRNA (ENSANAG00000001952.1)
    2. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000026839.2)
    3. Carlito syrichta miRNA (ENSTSYG00000020071.2)
    4. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000022109.1)
    5. Chlorocebus sabaeus miRNA (ENSCSAG00000024734.1)
    6. Colobus angolensis palliatus miRNA (ENSCANG00000007941.1)
    7. Dasypus novemcinctus (nine-banded armadillo) microRNA 301a (ENSDNOG00000031572.1)
    8. Echinops telfairi microRNA 301a (ENSETEG00000022308.1)
    9. Equus asinus asinus (donkey) miRNA (ENSEASG00005002531.1)
    10. Equus caballus microRNA eca-mir-301a precursor
    11. Gorilla gorilla gorilla microRNA 301a (ENSGGOG00000033263.2)
    12. Macaca fascicularis miRNA (ENSMFAG00000014582.2)
    13. Macaca mulatta microRNA mml-mir-301a precursor
    14. Macaca nemestrina miRNA (ENSMNEG00000004218.1)
    15. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000016384.1)
    16. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000019239.3)
    17. Nomascus leucogenys miRNA (ENSNLEG00000025448.2)
    18. Oryctolagus cuniculus microRNA 301a (ENSOCUG00000019161.1)
    19. Pan paniscus miRNA (ENSPPAG00000011803.1)
    20. Pan troglodytes (chimpanzee) ptr-mir-301a (ENSPTRG00000027584.2)
    21. Papio anubis miRNA (ENSPANG00000014709.2)
    22. Piliocolobus tephrosceles miRNA (ENSPTEG00000038653.1)
    23. Pongo abelii microRNA 301a (ENSPPYG00000021192.1)
    24. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000008211.1)
    25. Propithecus coquereli miRNA (ENSPCOG00000011090.1)
    26. Pteropus vampyrus microRNA 301a (ENSPVAG00000026275.1)
    27. Rhinolophus ferrumequinum microRNA 301a (ENSRFEG00010011502.1)
    28. Rhinopithecus bieti miRNA (ENSRBIG00000010974.1)
    29. Rhinopithecus roxellana miRNA (ENSRROG00000004996.1)
    30. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000036408.1)
    31. Theropithecus gelada microRNA 301a (ENSTGEG00000021634.1)
    32. Tupaia belangeri microRNA 301a (ENSTBEG00000018011.1)
    2D structure New