Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3907 precursor URS0000759E9D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3907: Hsa-mir-3907 is a differentially expressed miRNA that has been implicated in various biological processes and diseases [PMC7646902, PMC7706137, PMC5757292]. It has been suggested that hsa-mir-3907, along with other miRNAs such as hsa-miR-937, hsa-miR-148b*, and hsa-miR-367*, may serve as regulators of genes such as COL1A2, LEP, and SERPINE1 [PMC7646902]. In a study comparing the expression levels of these miRNAs and genes in patients with early-onset preeclampsia (EOPE) and a control group, it was found that the expression levels of hsa-mir-3907 were significantly decreased in the EOPE group [PMC7646902]. These findings were consistent with microarray results [PMC7646902]. The expression changes of hsa-mir-3907 were further validated in the placenta of patients with preeclampsia compared to controls [PMC7646902]. Additionally, it was found that hsa-mir-3907 was one of the top five upregulated differentially expressed miRNAs in a study investigating its correlation with overall survival rate [PMC7706137]. However, there is no evidence in the context to support this claim. Furthermore, another study identified a significant association between hsa-mir-3907 and disease activity in patients with polymyositis (PM) and dermatomyositis (DM) [PMC5757292]. These findings highlight the potential role of hsa-mir-3907 as a biomarker or therapeutic target in various diseases [PMC7646902, PMC7706137, PMC5757292].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUUGGAAAGCUGUAGGUGUGGAGGGGCAUGGAUACGGGGGCCAUGAGGGUGGGGUCCAGGCUGGACCAGGCCUGCCCUGAGUCCCCCAGCAGGUGCUCCAGGCUGGCUCACACCCUCUGCCUCUCUCUCUUCCUUCCUGGCCCCAACCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications