Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-764 URS0000759DF8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-764: Interestingly, we also observed three DEmiRNAs, hsa-miR-181a-2-3p, hsa-mir-764 and kshv-miR-K12-6-3p, whose expression in the tissue and blood were entirely opposite [PMC6591379]. This interesting result suggests the need for further investigation into the exact mechanism of hsa-mir-764 in the onset and progression of SCG [PMC6591379]. Previous research has shown that hsa-mir-764 is a biomarker for the diagnosis of hepatocellular carcinoma and lung adenocarcinoma [PMC6591379]. Additionally, hsa-mir-764, along with hsa-miR-181a-2-3p and kshv-miR-K12-6-3p, has been found to be up-regulated in blood but down-regulated in tissues [PMC6591379]. Hsa-mir-764 is located in the second intron of Human serotonin receptor 2C (HTR2C) [PMC2258288]. PCR primers have been used to study hsa-mir-764, including forward primer 5'-GCAGGTGCTCACTTGTCCTCCT' and reverse primer 5'-GCGAGCACAGAATTAATACGAC' [PMC8647233][PMC9254875]. Hsa-mir-764 is one of the top miRNAs with a strong ability to interact with circ-G042080, along with hsa-miR-4268 and hsa-miR3907 [PMC8201884]. It has also been identified as a potential regulator of C2CD4A based on bioinformatics predictions [PMC8520208]. Hsa-mir-764 is among the top 10 differentially expressed miRNAs, along with miRNAs such as hsa-miR31–5p and hsa–miR224–5p [PMC7191371].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGGUGCUCACUUGUCCUCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications