Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3661 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3661 precursor URS0000759DAE_9606

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACCUUCUCGCAGAGGCUCUUGACCUGGGACUCGGACAGCUGCUUGCACUCGUUCAGCUGCUCGAUCCACUGGUCCAGCUCCUUGGUGAACACCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 3661 (ENSANAG00000002088.1)
  2. Callithrix jacchus (white-tufted-ear marmoset) microRNA 3661 (ENSCJAG00000037690.3)
  3. Canis lupus dingo microRNA 3661 (ENSCAFG00020001312.1)
  4. Canis lupus familiaris miRNA (ENSCAFG00000030722.2, ENSCAFG00030009731.1, ENSCAFG00040007777.1, ENSCAFG00845012673.1)
  5. Cebus imitator (Panamanian white-faced capuchin) microRNA 3661 (ENSCCAG00000003742.1)
  6. Cercocebus atys microRNA 3661 (ENSCATG00000009631.1)
  7. Chlorocebus sabaeus (African green monkey) microRNA 3661 (ENSCSAG00000020291.1)
  8. Equus asinus asinus microRNA 3661 (ENSEASG00005018497.1)
  9. Equus asinus (ass) microRNA 3661 (ENSEASG00005018497.2)
  10. Equus caballus (horse) microRNA 3661 (ENSECAG00000032971.1)
  11. Gorilla gorilla gorilla microRNA 3661 (ENSGGOG00000042187.1)
  12. Macaca mulatta microRNA 3661 (ENSMMUG00000049256.2)
  13. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000020800.1)
  14. Neogale vison microRNA 3661 (ENSNVIG00000016782.1)
  15. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3661 (ENSNLEG00000022837.2)
  16. Oryctolagus cuniculus (rabbit) microRNA 3661 (ENSOCUG00000037514.1)
  17. Pan troglodytes microRNA 3661 (ENSPTRG00000041512.2)
  18. Papio anubis microRNA 3661 (ENSPANG00000019653.3)
  19. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 3661 (ENSPTEG00000035261.1)
  20. Prolemur simus microRNA 3661 (ENSPSMG00000020509.1)
  21. Propithecus coquereli (Coquerel's sifaka) microRNA 3661 (ENSPCOG00000011209.1)
  22. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000036401.1)
  23. Theropithecus gelada (gelada) microRNA 3661 (ENSTGEG00000020460.1)
  24. Ursus americanus microRNA 3661 (ENSUAMG00000018179.1)
  25. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 3661 (ENSUTTG00000010100.1)
  26. Vulpes vulpes microRNA 3661 (ENSVVUG00000021371.1)
2D structure Publications