Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6825-5p URS0000759D52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6825: Among the identified genes in the present study, LINC02683, AC244517.5, LINC02418, LINC01322, AC011468.3, and hsa-mir-6825 were identified as risk factors [PMC8236863]. Patients with high expression of hsa-mir-6825 had a lower recurrence-free survival compared to those with low expression [PMC8236863]. The study also reported the identification of LINC02683, AC244517.5, LINC02418, LINC01322, AC011468.3, AC020637.1, and AC027117.2 for the first time in lung squamous cell carcinoma (LUSC) [PMC8236863]. In mice, hsa-mir-6825 was shown to increase LDLR mRNA expression by reducing PCSK9/SREBP2 interaction [PMC9263516]. Hsa-mir-6825 mimic and inhibitor were used in experiments conducted on HL-1 cardiomyocyte cells to determine its expression and its role in PCSK9 regulation [PMC8389247]. Pterostilbene was found to suppress PCSK9 epigenetically through hsa-mir-6825 mediated downregulation of SREBP2, leading to increased LDLR mRNA expression [PMC8389247]. Pterostilbene also reduced PCSK9/SREBP2 interaction and mRNA expression by increasing the expression of hsa-mir-6825, thereby increasing LDLR mRNA expression [PMC8389247].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGGGAGGUGUGGAGUCAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications