Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520b precursor URS0000759D0E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520B: MIR520B is a miRNA gene that belongs to the C19MC miRNA gene cluster [PMC6193703]. Constructs with different deletions of the 5′-flanking region of the MIR520B promoter were generated [PMC6426848]. These constructs were created in a similar manner to the (−2000/ + 500) MIR520B construct, which was generated from human genomic DNA [PMC6426848]. The expression of MIR520B was analyzed in breast invasive carcinoma using miRNASeq data, which included normal and primary breast cancers [PMC6193703]. Bufalin, a compound, was found to suppress migration and invasion of PC cell lines. However, when HOTAIR was overexpressed, it counteracted the effects of bufalin and increased migration and invasion activities. This occurred through direct sponging of MIR520B by HOTAIR, resulting in increased expression of FGFR1, which is a target gene of MIR520B [PMC9953056]. Doxorubicin treatment downregulated several miRNAs including MIR520B in hepatocellular carcinoma (HCC). The downregulation also affected their target genes such as ABCB1, ABCF2, PKM2, Mcl-1, ULK1, YAP1 AEG-1 and ATG7 [PMC8308499]. The TCGA miRNA-seq dataset for HCC was used to analyze the expression levels of all 46 C19MC miRNA genes including MIR520B. This dataset was integrated with RNA-seq data from HCC-iCluster for further analysis [PMC7378193].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUCUACAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUUUAGAGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications