v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BMPR1B divergent transcript (BMPR1B-DT) URS0000759CD9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BMPR1B-DT: BMPR1B-DT is a long non-coding RNA (lncRNA) that has been identified as one of the seven prognostic NRLncRNAs in various cancers, including ovarian cancer and endometrial carcinoma [PMC9988759]. It has been found to be co-expressed with the necroptosis-related gene TRAF5 in ovarian cancer, suggesting a potential role in necroptosis regulation [PMC9988759]. Additionally, BMPR1B-DT has been shown to be associated with drug sensitivity and can be used as a prognostic marker in ovarian cancer [PMC9360323]. In endometrial carcinoma, BMPR1B-DT is upregulated and its downregulation is associated with an increase in the number of deaths [PMC8806566]. It is considered a protective factor (HR < 1) in ovarian cancer and its expression level is inversely correlated with the risk score [PMC8806566]. Furthermore, BMPR1B-DT has been identified as one of the key lncRNAs for predicting survival in ovarian cancer patients [PMC8806566]. LASSO regression analysis has also identified BMPR1B-DT as one of the six differentially expressed lncRNAs used to construct a risk signature for predicting survival in ovarian cancer patients [PMC8806566]. Overall, BMPR1B-DT plays an important role in various cancers and can serve as a potential prognostic marker and therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGAGCUGGAAAGGGCUCGCAGAGAUGAUAUAAUGUCGUGGAUUUCAACUUUUCGGGGCCAUAGACACUUUUCAGAAAUUGAUAAAACGUUGACACACCUUGUAAAAAAUGAACACAUUAAAAUUAAGCCUGCAGUUUGAGGUAAUGGAGAAGCACUGGAGAUUUGUAAGCCACGGAGUCAAAUGGUGGACUGGGAUUUUCAGGAGAUCAUUUAGAGAGCAAGAUCUUACCAAAUCCUUUAGUCAUGGUCUAUUUCGUUGCACUCAUAUGGUUGUUACUGCGAAGGUGAAGAACUAAUGACUGCAGCAGGAAAAAGAAUUGGAUGUGUCAUGAAUUAUGGCCCUGCUUAUACUUCUACUUCAACCGUAAUCAUUUGUUUAAACAAAAAGUUCUGCAUUUGAAUUGUCACAAUUGUGUGUGUGUUAUAAACAUCUCAUAUUUCAUCCAGGCUCAGCCAACACUUGCCUUUAUUAAUGCUCAUAAUCAAGAAAUAAAAUCUCAUACUAACCAAAAAUUAUCCUUCAUAAGAGAAUAUAAACAGAAGUCUGGUUCAUAAACUUACUAAUUAACACCUCUAUUCUCAUGUAUCAACUAACAUUUUUGUUUCGUCUUAAAAUAAAUAAAACUUUAUGACAUGCUAAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications