Homo sapiens (human) microRNA hsa-mir-4483 precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4483 precursor URS0000759CBB_9606

62 nucleotides
5 databases (Ensembl, GeneCards, HGNC, miRBase, RefSeq)
Found in 0 other species
16 publications
1. transcript
2. pre-miRNA

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4483: MIR4483 is a gene associated with migraines without aura and obesity-related traits [PMC4880969]. It is located in the intergenic region between the PLEKHS1 and MIR4483 genes [PMC4880969]. Selective sweeps were identified downstream of the TCF7L2 gene, and this region contained several genes, including HABP2, NRAP, CASP7, PLEKHS1, MIR4483, DCLRE1A, and NHLRC2 [PMC4880969]. The downstream region of TCF7L2 was found to be within a block of hard selection sweeps that encompassed genes involved in metabolism such as PLEKHS1 and MIR4483 [PMC4880969]. Additionally, this region contained other genes such as GPAM, TECTB, MIR6715A/B, GUCY2GP, ACSL5, ZDHHC6, VTI1A, MIR4295, LOC103344931, ADRB1, and CCDC186 [PMC4880969]. Furthermore, miR4483 was found to be one of the 11 miRNAs identified in a study [PMC9307901].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAAAAACAACAUACUUAGUGCAUACCCAUAUAAUAUUAGGGGUGGUCUGUUGUUGUUUUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications