Mus caroli (Ryukyu mouse) microRNA 344-2 (MGP_CAROLIEiJ_G0008118.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus caroli (Ryukyu mouse) microRNA 344-2 (MGP_CAROLIEiJ_G0008118.1) URS0000759C8E_10089

80 nucleotides
1 database (Ensembl)
Found in 4 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UUUUUACCAGUCAGGCUCCUGGCUAGAUUCCAGGUACCAACUGGUACCUGAUCUAGCCAAAGCCUGACUGUAAGCUGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Mus musculus microRNA mmu-mir-344 precursor (mmu-mir-344-2)
Mus pahari microRNA 344-2 (MGP_PahariEiJ_G0006557.1)
Mus spretus (algerian mouse) microRNA 344-2 (MGP_SPRETEiJ_G0008542.1)