Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-411 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-411 precursor URS0000759C2D_9606

  • 96 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 21 species

Automated summary: This pre miRNA sequence is 96 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl, ENA, Ensembl/GENCODE, GeneCards, RefSeq, HGNC, MalaCards, miRBase). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-411 precursor sequence is a product of hsa-mir-411 precursor, mir-411 precursor, MIR411, mir-411 precurso, mir-411 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCAAAUCCAUCCCCGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 20 other species

    1. Aotus nancymaae miRNA
    2. Carlito syrichta (Philippine tarsier) miRNA
    3. Cercocebus atys (Sooty mangabey) miRNA
    4. Colobus angolensis palliatus microRNA 411
    5. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 411
    6. Macaca fascicularis (Crab-eating macaque) miRNA
    7. Macaca nemestrina miRNA
    8. Mandrillus leucophaeus (Drill) miRNA
    9. Microcebus murinus miRNA
    10. Mus spicilegus miRNA
    11. Ochotona princeps miRNA
    12. Otolemur garnettii (small-eared galago) miRNA
    13. Pan troglodytes (chimpanzee) ptr-mir-411
    14. Papio anubis (Olive baboon) miRNA
    15. Pongo abelii microRNA 411
    16. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-411 precursor
    17. Propithecus coquereli (Coquerel's sifaka) miRNA
    18. Rattus norvegicus microRNA 411 (Mir411)
    19. Rhinopithecus bieti miRNA
    20. Rhinopithecus roxellana miRNA
    21. Saimiri boliviensis boliviensis miRNA
    22. Tupaia belangeri microRNA 411
    2D structure New