Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) microRNA rno-mir-207 precursor secondary structure diagram

Rattus norvegicus (Norway rat) microRNA rno-mir-207 precursor URS0000759BD0_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-207: Rno-mir-207 is a microRNA that has been studied in various contexts. It has been identified as one of the specific TaqMan miRNA assays used in a study [PMC5599553]. However, in another study, the trimming of rno-mir-207 was not detected, possibly due to low abundance [PMC3441217]. Rno-mir-207 has been found to be involved in the repression of negative modulators [PMC5920094]. It has also been identified as a down-regulator of genes differentially expressed in rat lung tissues exposed to certain substances [PMC6940784]. In a study comparing different treatment groups, rno-mir-207 was found to be downregulated in one group compared to another [PMC7768166]. Rno-mir-207 has been associated with circRNA chr1:185495031|185495489 and the gene Csf1, which plays a role in prevention of fibrosis [PMC7768166]. It is also involved in cell proliferation, apoptosis, migration, epithelial–mesenchymal transition (EMT), and cytoskeleton remodeling [PMC7768166]. Rno-mir-207 has been associated with the positive regulation of cell proliferation and regulation of calcium ion transport as well as protein kinase B signaling cascade and NF-кB transcription factor activity [PMC5102036]. In various studies, rno-mir-207 expression levels have been found to be altered under different conditions or treatments such as exposure to certain substances or induction of osteogenic differentiation by tacrolimus [PMC8603511].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCAGGGGUGAGGGGCUGCGGGAGGAGCGGGGCGGAGGCUGCGGCUUGCGCUUCUCCUGGCUCUCCUCCCUUUCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications