Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-6240 URS0000759AC8_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-6240: Mmu-mir-6240 is a miRNA that has been found to be downregulated in various studies [PMC9650897][PMC8890746][PMC9321239]. It was downregulated in qRT-PCR analysis, except for poorly conserved miRNAs [PMC9650897]. It has been identified as a potential microRNA related to DARPP-32 in mice [PMC10132208]. Mmu-mir-6240 was also validated through qPCR in miRNA-Seq findings [PMC8890746]. In a study using microarray analysis, mmu-mir-6240 was found to be upregulated in the LPS-treated group compared to the control group [PMC7945321]. Mmu-mir-6240 has also been identified as a potential biomarker for different time points after ischemic stroke [PMC6798056]. Following cerebral ischemia-reperfusion, mmu-mir-6240 expression levels were reduced over time, while other miRNAs were upregulated at peak levels 7 days after reperfusion [PMC6798056]. Mmu-mir-6240 is one of the significantly downregulated known sRNAs after cerebral ischemia-reperfusion [PMC9321239]. It has also been identified as differentially expressed in a time course study of brain injury and recovery [PMC7994852]. In network analysis, mmu-mir-6240 was found to be upregulated in certain conditions and related to neural and skeletal development in zebrafish [PMC5225001]. Additionally, mmu-mir-6240 is part of the biosignature targeting transcripts related to energy metabolism and inositol phosphate metabolism pathways [PMC9640326].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAAAGCAUCGCGAAGGCCCACGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications