Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3115 (ENSNLEG00000024052.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 3115 (ENSNLEG00000024052.2) URS0000759AC2_61853

68 nucleotides
1 database (Ensembl)
Found in 8 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCUGAAUAUGGGUUUACUAGUUGGUGGUGAAUUCAUGAGUCGCCAACUAUUAGGCCUUUAUGUCCAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Castor canadensis (American beaver) miRNA (ENSCCNG00000029328.1)
Gorilla gorilla gorilla microRNA 3115 (ENSGGOG00000042379.1)
Homo sapiens microRNA hsa-mir-3115 precursor
Microcebus murinus (gray mouse lemur) microRNA 3115 (ENSMICG00000035594.2)
Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000027507.1)
Pan troglodytes microRNA 3115 (ENSPTRG00000039021.2)
Pongo abelii miRNA (ENSPPYG00000037813.1)
Sus scrofa (pig) microRNA 3115 (multiple genes)