Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mus musculus (house mouse) microRNA mmu-mir-101a precursor secondary structure diagram

Mus musculus (house mouse) microRNA mmu-mir-101a precursor URS0000759A58_10090

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Mus musculus. Annotated by 6 databases (Ensembl/GENCODE, RefSeq, Ensembl, ENA, MGI, miRBase). Described in 34 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-101, RF00253). Mus musculus (house mouse) microRNA mmu-mir-101a precursor sequence is a product of Mir101a, mir-101a precursor, mir-101a, mir-101a precurso, mmu-mir-101a precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGCUGCCCUGGCUCAGUUAUCACAGUGCUGAUGCUGUCCAUUCUAAAGGUACAGUACUGUGAUAACUGAAGGAUGGCAGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Ailuropoda melanoleuca (giant panda) microRNA 101-1 (MIR101-1)
    2. Balaenoptera musculus miRNA
    3. Bison bison bison (American bison) microRNA 101-1 (MIR101-1)
    4. Bos grunniens (domestic yak) microRNA 101-1
    5. Bos indicus x Bos taurus microRNA 101-1
    6. Bos mutus microRNA 101-1 (MIR101-1)
    7. Bos taurus (cattle) microRNA bta-mir-101 precursor (bta-mir-101-1)
    8. Callithrix jacchus cja-mir-101-1
    9. Camelus dromedarius (Arabian camel) microRNA 101-1
    10. Canis lupus dingo microRNA 101-1
    11. Canis lupus familiaris microRNA 101-1
    12. Capra hircus (goat) microRNA chi-mir-101 precursor
    13. Castor canadensis microRNA 101a
    14. Catagonus wagneri (Chacoan peccary) microRNA 101-1
    15. Chlorocebus sabaeus (African green monkey) miRNA
    16. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 101-1
    17. Dasypus novemcinctus (nine-banded armadillo) microRNA 101-1
    18. Delphinapterus leucas microRNA 101-1
    19. Dipodomys ordii microRNA 101a (Mir101a)
    20. Echinops telfairi miRNA
    21. Felis catus (domestic cat) miRNA
    22. Ictidomys tridecemlineatus microRNA 101-1
    23. Loxodonta africana microRNA 101-1
    24. Lynx canadensis (Canada lynx) microRNA 101-1
    25. Macaca fascicularis miRNA
    26. Macaca mulatta mml-mir-101-1
    27. Marmota marmota marmota microRNA 101-1
    28. Meriones unguiculatus miRNA
    29. Mesocricetus auratus (Golden Hamster) microRNA 101a (Mir101a)
    30. Microtus ochrogaster microRNA 101a
    31. Monodon monoceros (narwhal) miRNA
    32. Moschus moschiferus microRNA 101-1 (MIR101-1)
    33. Mus caroli microRNA 101a
    34. Mus pahari microRNA 101a
    35. Mus spicilegus microRNA 101a
    36. Mus spretus microRNA 101a
    37. Mustela putorius furo (Domestic ferret) microRNA 101-1
    38. Myotis lucifugus microRNA 101-1
    39. Nannospalax galili microRNA 101a (Mir101a)
    40. Neovison vison microRNA 101-1
    41. Ornithorhynchus anatinus oan-mir-101-1
    42. Ovis aries miRNA
    43. Panthera leo (lion) microRNA 101-1
    44. Peromyscus maniculatus bairdii (Northern American deer mouse) microRNA 101a
    45. Phocoena sinus (vaquita) miRNA
    46. Physeter catodon (sperm whale) microRNA 101-1
    47. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 101-1
    48. Pongo abelii microRNA 101-1
    49. Prolemur simus microRNA 101-1
    50. Pteropus vampyrus microRNA 101-1
    51. Rattus norvegicus microRNA 101a (Mir101a)
    52. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 101-1
    53. Spermophilus dauricus miRNA
    54. Suricata suricatta (meerkat) microRNA 101-1
    55. Sus scrofa (pig) miRNA (MIR101-2, ssc-mir-101-2)
    56. Theropithecus gelada microRNA 101-1
    57. Tupaia belangeri miRNA
    58. Tursiops truncatus (bottlenosed dolphin) microRNA 101-1 (MIR101-1)
    59. Urocitellus parryii microRNA 101-1
    60. Ursus americanus (American black bear) microRNA 101-1
    61. Ursus maritimus (Polar bear) microRNA 101-1
    62. Ursus thibetanus thibetanus (Asiatic black bear) microRNA 101-1
    63. Vicugna pacos (alpaca) microRNA 101-1 (MIR101-1)
    64. Vulpes vulpes microRNA 101-1
    65. Zalophus californianus miRNA
    2D structure New