v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sorex araneus (European shrew) microRNA 497 (ENSSARG00000016402.1) secondary structure diagram

Sorex araneus (European shrew) microRNA 497 (ENSSARG00000016402.1) URS00007599E5_42254

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCAGCAGCACACUGUGGUUUGUACGGCACUGUGGCCACGUCCAAACCACACUGUGGUGUUAGAGCGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Loxodonta africana (African savanna elephant) microRNA 497 (ENSLAFG00000024521.1)
  2. Pan troglodytes microRNA ptr-mir-497 precursor
  3. Rattus norvegicus microRNA rno-mir-497 precursor
 2D structure Publications