Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-3552 URS0000759918_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-3552: Rno-mir-3552 is a novel miRNA candidate that aligns perfectly with rno-mir-3552 and has conserved genomic contexts [PMC3402511]. In a study comparing the MCAO group with the sham group, six miRNAs, including rno-mir-3552, were found to be upregulated, while only rno-mir-194-1 was downregulated [PMC5713304]. Rno-miR-107-5p, rno-miR-196b-5p, and rno-mir-3552 were found to target H2afz, Ptprc, and Srsf2 genes respectively [PMC5713304]. Functional enrichment analysis was conducted to explore the function of targeted mRNAs regulated by rno-mir-3552 [PMC7381948]. In MCAO rat brain tissues, CASP3 was significantly highly expressed while rno-mir-3552 was significantly lowly expressed in MCAO rat blood samples [PMC7381948]. Rno-mir-3552 was found to potentially target Esrrg, Gng7, Nalcn, Clasp2, Faim2 Mast3 and Pip5k1c genes [PMC7381948]. RT-qPCR validation confirmed that rno-mir-3552 was significantly down-regulated in both blood and brain tissue samples of MCAO rats [PMC7381948]. TargetScan miRTarBase miRDB miRanda and miRMap databases were used to predict the corresponding miRNA-mRNA regulatory relationship pairs for targeted mRNAs of rno-mir 3552 [PMC7381948]. Nine differentially expressed miRNAs were identified between MCAO rat blood samples and sham-operated rat blood samples including rnomi-r191b rnomicr743a rnomicr12825p rnomicr3835p rnomir3552 rnomir1075p rnomir1373p rnomir1941 and rnomir429 [PMC7381948].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCUGCAGGCCCACUUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Mus musculus mmu-miR-3552
Publications